you cant even access that system anymore to check previous filings made using it
08.03.2026 22:05
👍 27
🔁 1
💬 3
📌 0
you cant even access that system anymore to check previous filings made using it
if you are confused as to how, simply ask yourself “what would the republicans do”when faced with something sensible like taxing the fuck out of billionaires?” that should make it easy. if that kind of thought eludes you, please step down.
@hakeem-jeffries.bsky.social hey idiot, the people don’t want this war. you, a representative of the people, can, in fact, represent the will of the people. we don’t care if AIPAC wrote “more war pls” in the memo of the checks you cash. shut it down. 1/
Even so, aren’t all the elections run by the states? Even if Florida and Texas try to take him balls deep by canceling their elections, what’s stopping any other states from continuing as normal?
frozen is ok since freedom unite is a solid pick
Why is Democratic Leadership taking money from AIPAC after all this?
Image of person pulling key from key cover. Key cover is a plush Khezu from the monster hunter game series. Key is coming out of Khezu’s mouth.
Image of plush Khezu key cover keychain attached to shoulder strap of brown bag.
thank you capcom
watching Hannity’s head catch fire will be fun though
genuinely shocked they didnt call in Jeffries, Schumer, and Torres to each raise their hands a few dozen times to pad the stats
WOLVERINE! Flip book. Next four frames. And yes those are his fingers on the last frame.
Morning sketch: WOLVERINE! vs ninjas. Decided to get back to the flip book I forgot about. Here’s the next sequence. Nunchucks!
Someone was abducted at 10 AM by ICE on Central Ave. Their coworker says they’ve lived here for over 20 years, are documented, and have 3 kids who were born here.
Don’t be fooled by headlines when they’ve been lying to us the whole time. We still need you out patrolling until every agent is gone.
I made a map of 3.4 million Bluesky users - see if you can find yourself!
bluesky-map.theo.io
I've seen some similar projects, but IMO this seems to better capture some of the fine-grained detail
The dumbest people on earth love this stuff and the most evil people on earth promote this stuff, so
A corgi's head barely surfacing atop deep snow, against a backdrop of an old wooden fence
I can officially confirm that the snow in NC is roughly one (1) corgi deep
We got a lot of snow
and a moment of dingus energy for your timeline
Sorry — we forgot to post this earlier! Alice sat down with @bysameng.com to talk about the incredible Skate Story.
www.rogue.site/editorials/s...
If they turn Kernan they’re cooked
DreamHaven Books owner Greg Ketter emerging from a cloud of tear gas that ICE agents fired into the streets of Minneapolis.
Remember the other day when I was saluting my friend Greg Ketter, owner of Minneapolis’ DreamHaven Books? This is him the following day. Greg will never say this, so I will — now is a great time to buy books from DreamHaven. Support Americans who stand up vs. 🧊. dreamhavenbooks.com
Call for Schumer and Jeffries to step down so actual leadership can be seen
the failure of Dem opposition still comes from the party being without shared beliefs such that the only message they can agree on is affordability.
the party as a whole won’t condemn cops. they won’t call for a wealth tax. they won’t call for expansive labor rights. they’re lost but hate the left.
please lose your primary
"Luther informed Hitler in no uncertain terms that the Reichsbank was not part of his revolution. It was an independent fiscal entity with an international board of directors."
(The parallels here to Trump vs Powell are uncanny--almost too on-the-nose, really.)
www.theatlantic.com/ideas/archiv...
My anger at having to stand outside my kid’s school for two hours to ensure none of their classmates, parents, or teachers get kidnapped by my own government is only slightly tempered by the amazing outpouring of support from other parents and especially neighbors who stand against this bullshit.
they have columbo
navigating piles of trash to get to every episode of columbo has speakeasy vibes
Somewhere, in the Deep reaches of space, an assembly has gathered on a space station. During a heated discussion on the design and capabilities of mecha, Isamu Kurogane (Lance) stands tall and dares to speak the truth. "Every Gundam is worse than Voltron because his hands are lion mouths!!!" he declares without shame. His bravado has impressed the Red Comet, Char Aznable, while confusing and insulting Amuro Ray. The delaration is heard to mixed reactions by many other mecha pilots (not by Shinji Ikari, he is doing his best to ignore him).
"LET HIM SPEAK!"
9" x 12" ink and watercolor on watercolor paper.
Realizing anytime I heard Country Roads I was being exposed to this fact without even knowing it
for universal translation:
agccacgagcacgagagaacccacgagtacacccacgagatgcacgagcacatcatgatcaccatcaccagc
