Collaborative research network on genome structural variants funded by the European Society of Evolutionary Biology (ESEB).
PhD candidate at the University of Otago exploring gene drives in eco-evolutionary models 🐀🧬💻
Postdoc - computational, evolutionary and conservation genomics @ the Globe Institute (University of Copenhagen) - 🦜👨🏻💻🧬
One lives only to make blunders.
🧬🌿 | Birds | Fish | My Cat
A PhD student with the Botanic Gardens of Sydney and USyd. Working on genetics behind Myrtle rust and paperbarks for restoration.
Tldr: #wetlands #plantdisease #genetics #botany #restoration #ecology
PhD student working on improving conservation genomics for threatened plants 🌿 Focused on methods, frameworks & cross-species insights 🌱 University of Sydney + Botanic Gardens of Sydney (ReCER)
Scientific Officer (Biodiversity Genomics) @ Research Centre for Ecosystem Resilience, Botanic Gardens of Sydney 🌱.
Palaeogenomics | Population Genomics
Currently in 🇦🇺, previously in 🇳🇿🇸🇪
Wildlife, trees, terrestrial ecology, dark skies, night, corvids, coffee, cats. | Expressive Language Disorder. AuDHD. Nonverbal. Mutism (“situational”, “selective”).
You do NOT have my permission to speak for me. Please don’t.
🦉Educator
💻Bioinformatics
🧬eDNA
🌱Molecular Ecology
🧫Biotech
🐶French Bulldogs
🥾Exercise is good
🔎 Looking for an unconventional 🧬eDNA project mentor https://www.linkedin.com/in/nicolemarieanthony
Neuroscientist studying behavioral genetics. General animal lover and science enthusiast.
eDNA population genetics, 🧬 herptofauna, indigenous data sovereignty, Pokémon, and everything in between!
Promoting science and industry collaboration across Australia and New Zealand to advance best practice eDNA methods and adoption in government, private and community sectors
Marine molecular ecologist | Jellyfish eDNA 🪼, eDNA ecology 🌊, Mapping and monitoring benthic environments 🌱
I study critters using DNA! 🐳🐬🐋 Ngāpuhi (Te Hikutū), Pākehā. He māmā ahau ki ngā tamariki e toru ki tua o te ārai me te pōtiki kua noho tonu ki te ao nei
Department of Biochemistry at the University of Otago
Te Tari Matū Koiora, Ōtākou Whakaihu Waka
Conservation genomics researcher @ MWLR in Aotearoa New Zealand 🧬🐦🐸🐛🌿 | Bird Nerd & President @birdsnewzealand.bsky.social | Secretary @scboceania.bsky.social | pākehā | she/her 🏳️🌈 Opinions are my own.
www.researchgate.net/profile/Natalie-Forsdick/research
Researcher, academic, artist, parent and caffeine addicted
Postdoc at Otago University | Genetic Biocontrol Strategies | Previously World Mosquito Program | Genomics Gene-Drive Insects | 🐝 🦟 🧬 🧪
Evolutionary biologist @Otago Uni. Researching rapid evolution in New Zealand insects. He/Him
UniAdl: BSc (Adv) (Honours)
Genetics & Evolutionary Biology
CATCTGATCATCGACAGCTAGCACCTGACA
Department of Microbiology and Immunology at the University of Otago
MPhil🔬 #salamander #ecology #toxin #parasite #Hong_Kong_newt
Australian Centre for Ancient DNA
…I make no errors, mistakes or blunders…
#DJ 🎶 #Genomics 🧪 #epigenetics 🧪 #epigenomics 🧪 #funky #indie #Gigs Anti- #ParentalAlienation 👨👩👧👦 Pro #EU 🇪🇺; #DJMilesy 🎶 #Cambridge, UK. Life is real good
PI of Neurogenetics group at Massey University, New Zealand. Likes playing with fly brains to learn about humans
MSc Biological Oceanography '24 @geomarkiel.bsky.social | Marine biologist wannabe🪸🤿 🌊 | HKU Ecology & Biodiversity '20 | Views are my own | She/her/hers
A/Prof Ryan Whitford - cereal scientist - whose translatable research outcomes are in wheat reproductive biology. “Nullius in verba.” Opinions are my own.
https://researchportal.murdoch.edu.au/esploro/profile/ryan_whitford
An independent organisation of distinguished Australian scientists, championing science for the benefit of all.
Read our landmark report: https://bit.ly/ASAF2035 #Science2035
Associate Professor, palaeoecologist, and science communicator @Otago Palaeogenetics Lab using ancient DNA and palaeontology to reconstruct past ecosystems.
🧬 The Genome • Unrestricted 🧪
Te Kāhui Mātai Manu o Aotearoa | The Ornithological Society of New Zealand - for all things birds in Aotearoa New Zealand. www.birdsnz.org.nz
BSc Genetics & Biomedical Science Student @ the University of Queensland 🫀🔬🧬
Founded in 1991, the International Genetic Epidemiology Society (IGES) is a professional scientific society devoted to the promotion of the study of genetic epidemiology and statistical genetics.
https://www.geneticepi.org/
Research scientist 🍇🖥️🌱🦠🔬
Plant Pathology | 3D+t imaging | MRI | Xrays tomography | IA | Image Analysis
Trunk diseases | Fungal Pathogens | Genetics | Molecular Biology | Grapevine | Breeding & Selection
Working at French Wine and Vine Institute
France
Use DNA to answer questions across the tree of life, from demography to diversity to disease. Scientist. Founder/CSO Freedom Genomics LLC
www.freegenllc.com
#genomics #bioinformatics #bigdata
#MSCA #Postdoc, Van Breusegem Lab #VIB -UGent Center for Plant Systems Biology #plantscience #redox
The Earth BioGenome Project (EBP), a moonshot for biology, aims to sequence, catalog, and characterize the genomes of all of Earth's eukaryotic biodiversity over a period of ten years.
🌲Keep up with all EBP updates: https://linktr.ee/earthbiogenomeproject
Official account of the ARC Centre of Excellence in Plants for Space (P4S), an international research consortium building novel solutions for long term space habitation and on-Earth sustainability.
www.plants4space.com
Accociate Professor at Durham University
Research Fellow at Girton College, Cambridge
Interested in population genomics, invasive species, hybridization, adaptation, speciation
The Australian Society of Plant Scientists (ASPS) promotes #PlantScience in Australia, and provides professional contact within our community #ASPS2025 #ozplants
https://asps-oz.github.io/asps-links/
A/Prof Research School of Biology, ANU
🇨🇦 Prof at UC in Aotearoa New Zealand 🇳🇿 #WearsManyHats #JugglesManyBalls incl Conservation Genomics #ConSERTeam🧬 IUCN SSC Conservation Translocation Specialist Group🕊️ PI @tepunahamatatini.bsky.social #KindnessInScience🔬 Opinions are my own.
Postdoctoral Research Fellow @ University of Edinburgh
🦠 Ancient Microbiomes 🧬 Dabbling in PopGen 🐻 Population Declines 🐾
previously @ University of Auckland 🇳🇿
Avid hiker and book worm 🐛
https://anniegwest.wixsite.com/anniegwest
Postdoc at Max Planck institute for Biology - Langer's Lab.
Interested in min-chromosomes, Haploid induction, epigenetics, genome stability, Arabidopsis, Magnaporthe. https://scholar.google.com/citations?user=Qlbm2YcAAAAJ&hl=en
Science journalist covering all fields. Formerly an editor at New Scientist and Nature. 🧪🐸 🍄
New Scientist: https://tinyurl.com/2tvwfa2b
Live Science: https://tinyurl.com/4mbyh7a9
Sci Am: https://tinyurl.com/bdza74ta
Nature: https://tinyurl.com/yc265esp
PhD Student at The University of Melbourne
NERC Independent Research Fellow based at University College London 🇨🇱🇦🇺🇬🇧
Nuts about mitochondria & mito nuclear epistasis. Interested in sexual conflict, diet & metabolism.
Associate Editor: Evolution Letters
Senior Research Fellow #SingleCell | #SpatialTranscriptomics
https://256wangliu.github.io/
Walter Benjamin Fellow at @armilabs.bsky.social Melbourne interested in all things developmental, regenerative, and evolutionary biology. @mpi-bio-fml.bsky.social alumnus. https://marcopodobnik.wordpress.com/
Associate Professor @VUMC #Hypertension, #kidney, #immunology #HostMicrobiotaInteraction. Mother of 2, wife. Associate Editor @CircRes
Research scientist | Evolution, pop gen & conservation genomics | views & typos are my own | 🐟🐺🧬
Postdoctoral research associate at the University of Sydney, applying genetic data and computational modelling to inform threatened species management.
phylogenetics, molecular evolution, some genomes, kids, dogs, and eclectic hobbies none of which I am much good at but I think for me that's the point
Ecology & Evolution, Research School of Biology, Australian National University
KeoghLab.com
Evolutionary biologist • Lab Head & ARC DECRA Fellow, Monash University • genomics • museums • phylo • conservation • #ozmammals • she/her • Wurundjeri & Bunurong Country, Australia
Evolutionary biologist at MQ (Wild Plant Genomics). Genomics, speciation, adaptation, mating systems, flower colour, genetic rescue, conservation and restoration, plant-pollinator interactions. Snapdragon, kangaroo paw, Eucalypt enthusiast
Head of Vertebrate Research Collections @CSIRO 🦎🥚🪶🧬 | Epigenomic Time-Machine | Evolution | Genomics | Reptile Sex Determination | Mother | STEMinist
Environmental DNA and molecular ecology, how and where it can impact conservation 🐸🐍🦟🩸🧬
https://linktr.ee/terangaranch
Native wildlife education in Southern CA. Our favorite members of the native wildlife community include mountain lions, bears, coyotes, bobcats, raccoons, opossums, birds of prey and reptiles. Los Angeles & Ventura
From Aotearoa, now a Lecturer based at UNE in NSW 🇦🇺 Non-native species, biosecurity, ecology & entomology. Loves ants 🐜 I always RT ecology jobs & PhD opps. She/her
Molecular Ecology of Invasive and Conserved Species
Archaeo/palaeogeneticist, soccer player, kitesurfer, hiker, sweet tooth, world citizen, globe trotter, fascinated by the natural world. My tolerance of haters is limited.
He/him
Sci journo, author of Pests: How Humans Create Animal Villains. Highly caffeinated. All bad takes mine. She/her
The premier international org of professionals who dedicate their work to advancing the science & practice of conservation.
Visit conbio.org to join.
Conservation biologist at The University of Sydney using population genetics, statistics and collaboration to help preserve biodiversity. Views my own.
Research fellow at Auckland Uni. Wannabe bioinformatician, reluctant community ecologist. Evolutionary ecology, microbial ecology. Anglican. He/him
professor at university Freiburg, ornithologist, conservation geneticist,
❤️outdoors, mountains ⛰️, open water swimming 🏊 and birds 🦤 (not necessarily always in this order, but sometimes all together)
#teamscience, #teamvorsicht #lowcarbonbirding
Professor, University of Auckland: urban ecology, conservation, invasive species. Mum to 2 teenagers. Nature fan. She/her. Aotearoa - New Zealand.
UOA profile: https://profiles.auckland.ac.nz/mc-stanley
Professor at University of Otago, NZ; Webster Chair in Virology; Rutherford Discovery Fellow. I like viruses and evolution.
🧠 Neuroscientist, PhD candidate, lapsed MD
🇦🇺 Monash (Neural Systems and Behaviour Lab), ex Uni Melbourne
👨🔬MRI processing, tractography, computational modelling, cog-neuro, addiction
ADHD 🌈
English & Persian flavors
Associate Professor in the School of BioSciences, University of Melbourne.
Metabolic signalling, circadian clocks.
Teacher of Genetics. Researcher of plants.
Dad. Runner.
https://blogs.unimelb.edu.au/haydonlab/
Molecular and morphological evolution of Australia's smallest marsupials. Conservation genetics of threatened Pilbara bats. Research Scientist. Perth, Western Australia.
Conservation geneticist in Boorloo/Perth
She/her | Ecology | Population & Landscape Genomics | Conservation Genetics
🦠 Postdoc in the Microbiome Manipulation Lab @ University of Toronto
🥝 Previously studying plant pathogen evolution with everyone's favourite P. syringae pathovar - Psa! ✨
🌿 hemara.nz
Wildlife & conservation genetics/omics, evolutionary ecology. Conservation geneticist working at Oxford Nanopore (ORG.one), but views are my own
PhD student at University of Sydney researching the genetics of marsupials and their diseases. Former classicist and library technician. I like solving puzzles and telling stories. She/her.
Genomics industry professional, molecular biologist, Dad, adventurer, amateur author/musician/athlete, employed by Illumina but opinions are my own
Senior Lecturer in Crop Physiology at The University of Queensland 🌱 Focused on improving yield and quality in grain legumes 🫘
Genomics, Machine Learning, Statistics, Big Data and Football (Soccer, GGMU)
Cereal phenology genetics PhD, Director of Finance & Entertainment #hylesbulkhaul #sharrowpastoral & Mum of 2
Promoting SciComm, teaching, equity & inclusion in plant biology. #PlantScience
PI NSF RCN: ROOT&SHOOT. https://rootandshoot.org/
Features Editor ThePlantCell, PlantPhysiology
@PlantTeaching@genomic.social
https://linktr.ee/PlantTeaching 🏴
Associate professor at Utrecht University, loves plant cell types & regulatory networks and their evolution.
Australian ecologist/botanist/horticulturist/nature nerd volunteering in Samoa. Into peat swamps, botany, fire, birds, Pacific issues, and other fun bits and pieces. Masters research student at University of New England.
Plant circadian biology at Department of Plant Sciences University of Cambridge.
May the #Roots be with you!
Associate Professor @ UCLouvain.
#OpenSci #SciComm #plant #drought #cereals #gamification #bread #teaching. 👩🦰👩 #dad.
#StandUpForScience
Pronoms : he/him
Personal webiste : https://www.guillaumelobet.be/
Scientist and Global Sales Director at 3i (@the.3i.social), foodie, family man. Tai Chi and meditation matter. Compassion Heals. Microscopes Rock. https://www.intelligent-imaging.com
Researcher in Fungal Biology 🍄🔬. Currently Postdoctoral Researcher at @CBGP_Madrid 🇪🇸 Former MSCA IF Postdoc at @ibvnice 🇫🇷 PhD from @tuBraunschweig 🇩🇪
I run the world's largest website about recently extinct and rediscovered taxa: https://recentlyextinctspecies.com/
Order our book (all royalties to charity): https://publish.csiro.au/book/8047/
PhD student in Multiscale Integrative Biology (UniMI) at the Molecular Imaging of Plants Lab
🌱Plants and science addicted🥼🔬
#plants #science #chronobiology #circadianrhythms #agriculture #climate #chronoagriculture #chronoagronomist #chronophytotechnology🧪
http://gojonnes.wordpress.com
ALT.
Profile pic: A forty years old Brazilian-Japanese
Official Daily Pollen Counts and Forecasts for #Melbourne, #Australia. A great resource if you have #hayfever or #asthma!
#DigitalHealth at its best.
#Pollen #ThunderStormAsthma
Senior Research Specialist (IR) @inrae-bfp.bsky.social
Gene Expression #genomics #transcription #chromatin #bioinformatics #rstats
Now working on polyploid cells in tomato 🍅
Formerly on 🌱 (Arabidopsis), 🍄 (Penicillium) , 🪰 (Drosophila), and 🐀 (Mouse)
Crop epigenomics and biotechnology. Group leader, The University of Queensland.
Senior Lecturer in Plant Pathology at the University of Melbourne. Fungal and bacterial genomics. Plant-microbe interactions. Population genomics. Biosecurity.
Professor at the Australian National University. Biosecurity, fungal and plant genomics, evolution, and biochemistry. Dad. Swimming, reading, nature.
